COMP N453S - GET-Evidence

Note: This variant has not been sufficiently evaluated by a GET-Evidence editor.

To be considered sufficiently evaluated a variant must have both "variant evidence" and "clinical importance" scores filled in.

Please help improve GET-Evidence by evaluating evidence for this variant!

Curation:
Currentness:

COMP N453S

(COMP Asn453Ser)


Short summary

 

Variant evidence
Computational -
Functional -
Case/Control -
Familial -
 
Clinical importance
Severity -
Treatability -
Penetrance -
 

Impact

Insufficiently evaluated pathogenic

(The "insufficiently evaluated" qualifier is assigned automatically based on the above evidence and importance scores.)

Inheritance pattern

unknown

Summary of published research, and additional commentary

 

Allele frequency

  • None available.

Publications
 

Genomes
 

Other external references
 

    GeneTests
  • GeneTests records for the COMP gene
    Multiple Epiphyseal Dysplasia, Dominant
    COMP-Related Multiple Epiphyseal Dysplasia
    Pseudoachondroplasia
    www.ncbi.nlm.nih.gov/sites/GeneTests/lab/gene/COMP
    Web search results (13 hits -- see all)
  • OMIM: 600310
    Overexpression of mutant COMP led to a dose-dependent decrease in cellular viability. ... 13 of the COMP gene which resulted in an asn453-to-ser (N453S) amino acid substitution ...
    www.genome.jp/dbget-bin/www_bget?omim+600310
  • Diverse Mutations in the Gene for Cartilage Oligomeric Matrix ...
    referred to as "thrombospondin 5." COMP is a modular. protein containing an amino-terminal ... the reported COMP-gene mutations that result in. PSACH or MED ...
    sciencedirect.com/science?_ob=MImg&...&ie=/sdarticle.pdf
  • Defects in the genes coding for cartilage extracellular ...
    Instead, an R718W mutation in COMP was identified in both families. ... patients with collagen IX mutations and patients with COMP mutations points to a ...
    herkules.oulu.fi/isbn9514277333/isbn9514277333.pdf
  • Structural Assessment of PITX2, FOXC1, CYP1B1, and GJA1 Genes ...
    © 2006 by The Association for Research in Vision and Ophthalmology, Inc. ... in the third exon (L432V, D449D, and N453S).20 Another polymorphism, previously reported ...
    www.iovs.org/cgi/content/full/47/5/1803
  • Structural Assessment of PITX2, FOXC1, CYP1B1, and GJA1 Genes ...
    D449D, and N453S). 20. Another polymorphism, previously re- ported in ... Assen, The Netherlands: Van Gorcum ad Comp NV; 1969. 2. Shields MB. Axenfeld-Rieger ...
    www.iovs.org/cgi/reprint/47/5/1803.pdf
  • Publications on the Vision Monitor
    and Comp., 1982, 2 ,23-28. CHARLIER J., MOUSSU, HACHE J.C. Optimization of computer ... of a common coding polymorphism (N453S) of the cytochrome P450 ...
    www.metrovision.fr/MFc25.html
  • BMC Cancer
    SNPs to be associated with complex disease risk [10]. Hence our analysis was largely ... coding N453S. 2. 38209790. A. G. TTCTTGGACAAGGAHGGCCTCATCA [A/ G]CAAGGACCTGACCAGCAGAGTGATG ...
    www.biomedcentral.com/content/pdf/1471-2407-7-123.pdf
  • Die Auswirkungen von Chondrodysplasie-assoziierten Mutationen ...
    COMP in which Asp361 was substituted by Tyr (D361Y) were both secreted into the ... exprimierte rekombinant Wildtyp-COMP, das strukturell und funktionell ...
    uni-koeln.de/med-fak/biochemie/.../diss/jochen_thur.pdf
  • Mendelian Inheritance in Man Document Reader
    MOLECULAR GENETICS COMP was a candidate gene for the site of the ... 13 of the COMP gene which resulted in an asn453-to-ser (N453S) amino acid substitution ...
    www.angis.org.au/bin/Databases/BIRX/birx_doc?phtomim+600310
  • BILATERAL HEREDITARY MICRO-EPIPHYSEAL DYSPLASIA
    (N453S) Aa. substitution. PSACH [COMP,ASP473GLY] Ikegawa. et al., 1998 ... linked to COMP, COL9A2 or COL9A3, respectively, and found significant. evidence for a MED ...
    igitur-archive.library.uu.nl/dissertations/.../c3.pdf

Other in silico analyses
 

  • NBLOSUM100 score = 0
  • GET-Evidence autoscore = 5

Edit history
 

Gene search

"GENE" or "GENE A123C":

Log in