COL17A1 SGGGGGVGG435Del - GET-Evidence

Note: This variant has not been sufficiently evaluated by a GET-Evidence editor.

To be considered sufficiently evaluated a variant must have both "variant evidence" and "clinical importance" scores filled in.

Please help improve GET-Evidence by evaluating evidence for this variant!



(COL17A1 435_443delSGGGGGVGGins)

Short summary


Variant evidence
Computational -
Functional -
Case/Control -
Familial -
Clinical importance
Severity -
Treatability -
Penetrance -


Insufficiently evaluated not reviewed

(The "insufficiently evaluated" qualifier is assigned automatically based on the above evidence and importance scores.)

Inheritance pattern


Summary of published research, and additional commentary


Allele frequency

  • -,GCCACCAACACCGCCACCTCCTCCACTGCC @ chr10:105806865: 4.9% (6/122) in GET-Evidence
  • Frequency shown in summary reports: 4.9% (6/122)



GS18501 - var-GS18501-1100-36-ASM
het - @ chr10:105806859


GS18508 - var-GS18508-1100-36-ASM
het - @ chr10:105806866


GS19703 - var-GS19703-1100-36-ASM
het - @ chr10:105806866


GS19704 - var-GS19704-1100-36-ASM
het - @ chr10:105806866


GS19834 - var-GS19834-1100-36-ASM
het - @ chr10:105806866


Other external references

Other in silico analyses

  • NBLOSUM100 score = 4
  • GET-Evidence autoscore = 3

Edit history

Gene search

"GENE" or "GENE A123C":

Log in