PKD1L2 Y2079Shift - GET-Evidence

Note: This variant has not been sufficiently evaluated by a GET-Evidence editor.

To be considered sufficiently evaluated a variant must have both "variant evidence" and "clinical importance" scores filled in.

Please help improve GET-Evidence by evaluating evidence for this variant!

Curation:
Currentness:

PKD1L2 Y2079Shift

(PKD1L2 2079delYinsShift)


Short summary

 

Variant evidence
Computational -
Functional -
Case/Control -
Familial -
 
Clinical importance
Severity -
Treatability -
Penetrance -
 

Impact

Insufficiently evaluated not reviewed

(The "insufficiently evaluated" qualifier is assigned automatically based on the above evidence and importance scores.)

Inheritance pattern

unknown

Summary of published research, and additional commentary

 

Allele frequency

  • None available.

Publications
 

Genomes
 

hu034DB1 - CGI sample GS00253-DNA_A02_200_37
het TACTGCCAAGCCTGGGGAAAGC @ chr16:81161474

 

hu0D879F - CGI sample GS00253-DNA_G01_200_37
hom TACTGCCAAGCCTGGGGAAAGC @ chr16:81161474

 

hu2D6140 - CGI sample GS01173-DNA_F06 from PGP sample 64191565
hom TACTGCCAAGCCTGGGGAAAGC @ chr16:81161474

 

hu44DCFF - CGI sample GS01669-DNA_C07 from PGP sample 74521372
het TACTGCCAAGCCTGGGGAAAGC @ chr16:81161474

 

hu72A81D - CGI sample GS01173-DNA_C02 from PGP sample 10366372
het TACTGCCAAGCCTGGGGAAAGC @ chr16:81161474

 

hu8229AE - CGI sample GS01173-DNA_A07 from PGP sample 96240009
het TACTGCCAAGCCTGGGGAAAGC @ chr16:81161474

 

hu92FD55 - CGI sample GS01669-DNA_A04 from PGP sample 08188426
het TACTGCCAAGCCTGGGGAAAGC @ chr16:81161474

 

huBAAC98 - CGI sample GS01173-DNA_F02 from PGP sample 70008981
het TACTGCCAAGCCTGGGGAAAGC @ chr16:81161474

 

huBEDA0B - CGI sample GS00253-DNA_C01_200_37
het TACTGCCAAGCCTGGGGAAAGC @ chr16:81161474

 

huCA017E - CGI sample GS01175-DNA_B01 from PGP sample 86206034
het TACTGCCAAGCCTGGGGAAAGC @ chr16:81161474

 

huD81F3D - CGI sample GS01173-DNA_D06 from PGP sample 69488604
het TACTGCCAAGCCTGGGGAAAGC @ chr16:81161474

 

Other external references
 

    dbSNP
  • rs71880246
    www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi

Other in silico analyses
 

  • NBLOSUM100 score = 4
  • GET-Evidence autoscore = 2

Edit history
 

Gene search

"GENE" or "GENE A123C":

Log in