OVGP1 Y514H - GET-Evidence

Note: This variant has not been sufficiently evaluated by a GET-Evidence editor.

To be considered sufficiently evaluated a variant must have both "variant evidence" and "clinical importance" scores filled in.

Please help improve GET-Evidence by evaluating evidence for this variant!

Curation:
Currentness:

OVGP1 Y514H

(OVGP1 Tyr514His)


Short summary

 

Variant evidence
Computational -
Functional -
Case/Control -
Familial -
 
Clinical importance
Severity -
Treatability -
Penetrance -
 

Impact

Insufficiently evaluated not reviewed

(The "insufficiently evaluated" qualifier is assigned automatically based on the above evidence and importance scores.)

Inheritance pattern

unknown

Summary of published research, and additional commentary

 

Allele frequency

  • G @ chr1:111957583: 25.1% (2699/10734) in EVS
  • TTCCCCAGGGGTCACAGACTGATGACCCACAG @ chr1:111759082: 1.4% (1/70) in GET-Evidence
  • Frequency shown in summary reports: 25.1% (2699/10734)

Publications
 

Genomes
 

GS18501 - var-GS18501-1100-36-ASM
het G @ chr1:111759106

 

GS18504 - var-GS18504-1100-36-ASM
het G @ chr1:111759106

 

GS18956 - var-GS18956-1100-36-ASM
het G @ chr1:111759106

 

GS19701 - var-GS19701-1100-36-ASM
het G @ chr1:111759106

 

Other external references
 

    dbSNP
  • rs1126656
    www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi
    PolyPhen-2
  • Score: 0 (benign)

Other in silico analyses
 

  • NBLOSUM100 score = –1
  • GET-Evidence autoscore = 0

Edit history
 

Gene search

"GENE" or "GENE A123C":

Log in