MMP9 A20V - GET-Evidence

Note: This variant has not been sufficiently evaluated by a GET-Evidence editor.

To be considered sufficiently evaluated a variant must have both "variant evidence" and "clinical importance" scores filled in.

Please help improve GET-Evidence by evaluating evidence for this variant!

Curation:
Currentness:

MMP9 A20V

(MMP9 Ala20Val)


Short summary

 

Variant evidence
Computational -
Functional -
Case/Control -
Familial -
 
Clinical importance
Severity -
Treatability -
Penetrance -
 

Impact

Insufficiently evaluated not reviewed

(The "insufficiently evaluated" qualifier is assigned automatically based on the above evidence and importance scores.)

Inheritance pattern

unknown

Summary of published research, and additional commentary

 

Allele frequency

  • T @ chr20:44637624: 1.7% (179/10756) in EVS
  • T @ chr20:44071030: 6.2% (8/128) in GET-Evidence
  • Frequency shown in summary reports: 1.7% (179/10756)

Publications
 

Genomes
 

 

hu72A81D - CGI sample GS01173-DNA_C02 from PGP sample 10366372
het T @ chr20:44637624

 

huAE6220 - CGI sample GS00253-DNA_H01_200_37
het T @ chr20:44637624

 

GS18537 - var-GS18537-1100-36-ASM
het T @ chr20:44071031

 

GS18555 - var-GS18555-1100-36-ASM
het T @ chr20:44071031

 

GS18942 - var-GS18942-1100-36-ASM
het T @ chr20:44071031

 

GS19648 - var-GS19648-1100-36-ASM
het T @ chr20:44071031

 

GS19669 - var-GS19669-1100-36-ASM
het T @ chr20:44071031

 

GS19735 - var-GS19735-1100-36-ASM
het T @ chr20:44071031

 

Other external references
 

    dbSNP
  • rs1805088
    www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi
    Web search results (24 hits -- see all)
  • MMP9 Gene - GeneCards | MMP9 Protein | MMP9 Antibody
    EntrezGene summary for MMP9: Proteins of the matrix metalloproteinase ... MMP9 Gene in genomic location: bands according to Ensembl, locations according ...
    www.genecards.org/cgi-bin/carddisp.pl?gene=MMP9
  • ASSAY_ID ASSAY_CODE CHROMOSOME_NAME HUGO_NAME GENE_CODE
    MMP9. MMP9. TCCTGCAGTGCCCTGAGGACTAGGG(T/C)TCCCGTCCTGCTTTGGCAGTGCCAT ... MMP9. MMP9. CTGGTGCTGGGCTGCTGCTTTGCTG(T/C)CCCCAGACAGCGCCAGTCCACCCTT. rs3918248/ rs1805088 ...
    med.stanford.edu/advance/documents/snps_phase_I.xls
  • Matrix metalloproteinase-9 precursor - Homo sapiens (Human)
    Defects in MMP9 may be a cause of susceptibility to intervertebral disc disease ... "Crystal structure of human MMP9 in complex with a reverse hydroxamate ...
    www.uniprot.org/uniprot/P14780
  • BioMed Central | Full text | Matrix Metalloproteinase-9 (MMP ...
    Although the reference alleles of seven polymorphisms in the Matrix Metalloproteinase-9 (MMP-9) gene are present at higher frequencies in people with melanoma, MMP-9 ...
    www.biomedcentral.com/1471-2350/8/10
  • METALLOPROTEINASE 9 BINDING PROTEINS - Patent application ...
    Patent application title: METALLOPROTEINASE 9 BINDING PROTEINS ... encoded by a gene designated as MMP9 with full name Matrix metalloproteinase-9 precursor. ...
    www.faqs.org/patents/app/20090311245
  • BMC Medical Genetics
    activation peptide domain (A20V, E82K), catalytic. domain (N127K, ... structure of MMP9. Figure 1. Localization of studied SNPs on a model structure of. MMP9. ...
    www.biomedcentral.com/content/pdf/1471-2350-8-10.pdf
  • XVIIth Belgian Week of Gastroenterology 2005
    HIGH DENSITY LIPOPROTEINS FACILITATE HEPATITIS C VIRUS ENTRY THROUGH INTERACTION ... ( 1) Laboratoire de Virologie Moleculaire ULB Hopital Erasme, Bruxelles, ...
    www.belgianweek.be/PDF/2005 BW Abstracts SPA.pdf
  • METALLOPROTEINASE 9 AND METALLOPROTEINASE 2 BINDING PROTEINS ...
    Patent application title: METALLOPROTEINASE 9 AND METALLOPROTEINASE 2 ... MMP9 or MMP-2 is no more than 10-fold higher than the Ki,app for the human MMP9 ...
    www.faqs.org/patents/app/20090297449
  • Supplementary Table xls.1
    ... kÇkükékâkäkàkåkçkêkëkèkïkîkìkÄkÅkÉkækÆkôkökòkûkùkÿkÖkÜk¢k£k¥k ... 0;\-"ú"#,##0*"ú"#,##0;[Red]\-"ú"#,##0*"ú"#,##0.00;\-"ú"#,##0.00**#*"ú"#,##0.00; ...
    icr.ac.uk/research/research_sections/.../2843.xls
  • NatureGeneticsApr2007Vol39No4pp454475
    ... iMCs express the matrix metalloproteinases MMP9 and MMP2 and the CC-chemokine ... matrix metalloproteinases MMP9. and MMP2. and the CC-chemokine receptor 1 (CCR1) and ...
    famshelp.gsc.riken.jp/famsbase/NatureGeneticsApr2007Vol39...

Other in silico analyses
 

  • NBLOSUM100 score = 2
  • GET-Evidence autoscore = 2

Edit history
 

Gene search

"GENE" or "GENE A123C":

Log in