Note: This variant has not been sufficiently evaluated by a GET-Evidence editor.

To be considered sufficiently evaluated a variant must have both "variant evidence" and "clinical importance" scores filled in.

Please help improve GET-Evidence by evaluating evidence for this variant!




Short summary


Variant evidence
Computational -
Functional -
Case/Control -
Familial -
Clinical importance
Severity -
Treatability -
Penetrance -


Insufficiently evaluated not reviewed

(The "insufficiently evaluated" qualifier is assigned automatically based on the above evidence and importance scores.)

Inheritance pattern


Summary of published research, and additional commentary


Allele frequency

  • CAAAGCCACCAGTGCCGAAACCAGCTCCGAAG @ chr12:51493853: 0.8% (1/126) in GET-Evidence
  • Frequency shown in summary reports: 0.8% (1/126)



hu011C57 - CGI sample GS01669-DNA_B05 from PGP sample 86486261


hu025CEA - CGI sample GS01669-DNA_D02 from PGP sample 27316983


hu034DB1 - CGI sample GS00253-DNA_A02_200_37


hu0E64A1 - CGI sample GS01173-DNA_B02 from PGP sample 94378523


hu241DEA - CGI sample GS01175-DNA_D05 from PGP sample 1205491


hu2D6140 - CGI sample GS01173-DNA_F06 from PGP sample 64191565


hu2DBF2D - CGI sample GS01173-DNA_G02 from PGP sample 67180598


hu342A08 - CGI sample GS01175-DNA_B05 from PGP sample 83494370


hu34D5B9 - CGI sample GS01173-DNA_C07 from PGP sample 92161424


hu38168C - CGI sample GS01173-DNA_H06 from PGP sample 91708424


hu3CAB43 - CGI sample GS01175-DNA_D03 from PGP sample 27486199


hu4040B8 - CGI sample GS01175-DNA_D01 from PGP sample 31286272


hu4339C0 - CGI sample GS01175-DNA_H01 from PGP sample 94797469


hu43860C - CGI sample GS00253-DNA_A01_200_37


hu44DCFF - CGI sample GS01669-DNA_C07 from PGP sample 74521372


hu4CA5B9 - CGI sample GS01669-DNA_B03 from PGP sample 14427241


hu604D39 - CGI sample GS00253-DNA_B02_200_37


hu72A81D - CGI sample GS01173-DNA_C02 from PGP sample 10366372


hu7A4AD1 - CGI sample GS01669-DNA_C05 from PGP sample 42408046


hu8229AE - CGI sample GS01173-DNA_A07 from PGP sample 96240009


hu92C40A - CGI sample GS01175-DNA_G03 from PGP sample 92527586


hu92FD55 - CGI sample GS01669-DNA_A04 from PGP sample 08188426


huA0E089 - CGI sample GS01175-DNA_B04 from PGP sample 88590671



huAE4A11 - CGI sample GS01669-DNA_F02 from PGP sample 40767107


huB1FD55 - CGI sample GS01173-DNA_B07 from PGP sample 61499538


huBAAC98 - CGI sample GS01173-DNA_F02 from PGP sample 70008981


huC30901 - CGI sample GS00253-DNA_B01_200_37


huCA017E - CGI sample GS01175-DNA_B01 from PGP sample 86206034


huD37D14 - CGI sample GS01175-DNA_A04 from PGP sample 13272228


huD81F3D - CGI sample GS01173-DNA_D06 from PGP sample 69488604


huE80E3D - CGI sample GS00253-DNA_D01_200_37


huFAF983 - CGI sample GS01175-DNA_F02 from PGP sample 95788191


huFFAD87 - CGI sample GS01669-DNA_H05 from PGP sample 10971581


GS06994 - var-GS06994-1100-36-ASM


GS07357 - var-GS07357-1100-36-ASM


GS10851 - var-GS10851-1100-36-ASM


GS12004 - var-GS12004-1100-36-ASM


GS18501 - var-GS18501-1100-36-ASM


GS18502 - var-GS18502-1100-36-ASM


GS18505 - var-GS18505-1100-36-ASM


GS18508 - var-GS18508-1100-36-ASM


GS18517 - var-GS18517-1100-36-ASM


GS18526 - var-GS18526-1100-36-ASM


GS18537 - var-GS18537-1100-36-ASM


GS18555 - var-GS18555-1100-36-ASM


GS18558 - var-GS18558-1100-36-ASM


GS18940 - var-GS18940-1100-36-ASM


GS18942 - var-GS18942-1100-36-ASM


GS18947 - var-GS18947-1100-36-ASM


GS18956 - var-GS18956-1100-36-ASM


GS19017 - var-GS19017-1100-36-ASM


GS19020 - var-GS19020-1100-36-ASM


GS19025 - var-GS19025-1100-36-ASM


GS19129 - var-GS19129-1100-36-ASM


GS19240 - var-GS19240-1100-36-ASM


GS19648 - var-GS19648-1100-36-ASM


GS19669 - var-GS19669-1100-36-ASM


GS19704 - var-GS19704-1100-36-ASM


GS19735 - var-GS19735-1100-36-ASM


GS19834 - var-GS19834-1100-36-ASM


GS20502 - var-GS20502-1100-36-ASM


GS20509 - var-GS20509-1100-36-ASM


GS21767 - var-GS21767-1100-36-ASM


Other external references

  • rs71092788
  • rs7135148
  • rs35271824
  • rs11267392

Other in silico analyses

  • NBLOSUM100 score = 4
  • GET-Evidence autoscore = 2

Edit history

Gene search

"GENE" or "GENE A123C":

Log in