KRT1 S557G - GET-Evidence

Note: This variant has not been sufficiently evaluated by a GET-Evidence editor.

To be considered sufficiently evaluated a variant must have both "variant evidence" and "clinical importance" scores filled in.

Please help improve GET-Evidence by evaluating evidence for this variant!


(See the latest version)

KRT1 S557G

(KRT1 Ser557Gly)

You are viewing an old version of this page that was saved on February 27, 2010 at 9:24pm by Genome Importing Robot.

Short summary


Variant evidence
Computational -
Functional -
Case/Control -
Familial -
Clinical importance
Severity -
Treatability -
Penetrance -


Insufficiently evaluated not reviewed

(The "insufficiently evaluated" qualifier is assigned automatically based on the above evidence and importance scores.)

Inheritance pattern


Summary of published research, and additional commentary


Allele frequency

  • C @ chr12:53069243: 22.3% (2034/9104) in EVS
  • ATAGCTGCCACCTCCGGAGCC @ chr12:51355501: 3.2% (3/94) in GET-Evidence
  • Frequency shown in summary reports: 22.3% (2034/9104)







Added in this revision:



Other external references

    Web search results (0 hits -- see all)

Other in silico analyses

  • NBLOSUM100 score = 2
  • GET-Evidence autoscore = 1

Edit history

Gene search

"GENE" or "GENE A123C":

Log in