KRT1 S557G - GET-Evidence

Note: This variant has not been sufficiently evaluated by a GET-Evidence editor.

To be considered sufficiently evaluated a variant must have both "variant evidence" and "clinical importance" scores filled in.

Please help improve GET-Evidence by evaluating evidence for this variant!


KRT1 S557G

(KRT1 Ser557Gly)

You are viewing the latest version of this page, saved on June 23, 2011 at 12:16am by Genome Importing Robot.

Short summary


Variant evidence
Computational -
Functional -
Case/Control -
Familial -
Clinical importance
Severity -
Treatability -
Penetrance -


Insufficiently evaluated not reviewed

(The "insufficiently evaluated" qualifier is assigned automatically based on the above evidence and importance scores.)

Inheritance pattern


Summary of published research, and additional commentary


Allele frequency

  • C @ chr12:53069243: 22.3% (2034/9104) in EVS
  • ATAGCTGCCACCTCCGGAGCC @ chr12:51355501: 3.2% (3/94) in GET-Evidence
  • Frequency shown in summary reports: 22.3% (2034/9104)



GS18526 - var-GS18526-1100-36-ASM
het C @ chr12:51355510




Deleted in this revision:



Other external references

  • rs66529359
    Web search results (0 hits -- see all)

Other in silico analyses

  • NBLOSUM100 score = 2
  • GET-Evidence autoscore = 1

Edit history

Gene search

"GENE" or "GENE A123C":

Log in