KRT1 SSYGSGG557Del - GET-Evidence

Note: This variant has not been sufficiently evaluated by a GET-Evidence editor.

To be considered sufficiently evaluated a variant must have both "variant evidence" and "clinical importance" scores filled in.

Please help improve GET-Evidence by evaluating evidence for this variant!

Curation:
Currentness:

KRT1 SSYGSGG557Del

(KRT1 557_563delSSYGSGGins)


Short summary

 

Variant evidence
Computational -
Functional -
Case/Control -
Familial -
 
Clinical importance
Severity -
Treatability -
Penetrance -
 

Impact

Insufficiently evaluated not reviewed

(The "insufficiently evaluated" qualifier is assigned automatically based on the above evidence and importance scores.)

Inheritance pattern

unknown

Summary of published research, and additional commentary

 

Allele frequency

  • TCCGGAGCC,TCCGGAGCCGTAGCTGCTACCT @ chr12:51355501: 42.6% (40/94) in GET-Evidence
  • Frequency shown in summary reports: 42.6% (40/94)

Publications
 

Genomes
 

hu025CEA - CGI sample GS01669-DNA_D02 from PGP sample 27316983
het - @ chr12:53069223

 

hu034DB1

 

hu0D879F

 

hu0E64A1 - CGI sample GS01173-DNA_B02 from PGP sample 94378523
het - @ chr12:53069223

 

hu241DEA - CGI sample GS01175-DNA_D05 from PGP sample 1205491
hom - @ chr12:53069223

 

hu342A08 - CGI sample GS01175-DNA_B05 from PGP sample 83494370
het - @ chr12:53069223

 

hu34D5B9 - CGI sample GS01173-DNA_C07 from PGP sample 92161424
het - @ chr12:53069223

 

hu43860C

 

hu6E4515 - CGI sample GS000005532
hom - @ chr12:53069235

 

hu72A81D - CGI sample GS01173-DNA_C02 from PGP sample 10366372
het - @ chr12:53069223

 

hu7A4AD1 - CGI sample GS01669-DNA_C05 from PGP sample 42408046
het - @ chr12:53069223

 

hu8229AE - CGI sample GS01173-DNA_A07 from PGP sample 96240009
het - @ chr12:53069223

 

hu92FD55 - CGI sample GS01669-DNA_A04 from PGP sample 08188426
het - @ chr12:53069223

 

huAE6220

 

huBAAC98 - CGI sample GS01173-DNA_F02 from PGP sample 70008981
het - @ chr12:53069223

 

huE80E3D

 

huFAF983 - CGI sample GS01175-DNA_F02 from PGP sample 95788191
het - @ chr12:53069223

 

GS18502 - var-GS18502-1100-36-ASM
het - @ chr12:51355493

 

GS18508 - var-GS18508-1100-36-ASM
hom - @ chr12:51355502

 

GS18517 - var-GS18517-1100-36-ASM
hom - @ chr12:51355502

 

GS18558 - var-GS18558-1100-36-ASM
het - @ chr12:51355502

 

GS19020 - var-GS19020-1100-36-ASM
het - @ chr12:51355502

 

GS19129 - var-GS19129-1100-36-ASM
het - @ chr12:51355493

 

GS19239 - var-GS19239-1100-36-ASM
het - @ chr12:51355493

 

GS19670 - var-GS19670-1100-36-ASM
het - @ chr12:51355502

 

GS19700 - var-GS19700-1100-36-ASM
hom - @ chr12:51355493

 

GS19704 - var-GS19704-1100-36-ASM
hom - @ chr12:51355502

 

GS19735 - var-GS19735-1100-36-ASM
hom - @ chr12:51355496

 

GS20509 - var-GS20509-1100-36-ASM
hom - @ chr12:51355502

 

Other external references
 

    dbSNP
  • rs61226348
    www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi
  • rs11170232
    www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi

Other in silico analyses
 

  • NBLOSUM100 score = 4
  • GET-Evidence autoscore = 1

Edit history
 

Gene search

"GENE" or "GENE A123C":

Log in