ICAM1 P352L - GET-Evidence

Note: This variant has not been sufficiently evaluated by a GET-Evidence editor.

To be considered sufficiently evaluated a variant must have both "variant evidence" and "clinical importance" scores filled in.

Please help improve GET-Evidence by evaluating evidence for this variant!

Curation:
Currentness:

ICAM1 P352L

(ICAM1 Pro352Leu)


Short summary

 

Variant evidence
Computational -
Functional -
Case/Control -
Familial -
 
Clinical importance
Severity -
Treatability -
Penetrance -
 

Impact

Insufficiently evaluated not reviewed

(The "insufficiently evaluated" qualifier is assigned automatically based on the above evidence and importance scores.)

Inheritance pattern

unknown

Summary of published research, and additional commentary

 

Allele frequency

  • T @ chr19:10395208: 2.2% (238/10748) in EVS
  • T @ chr19:10256207: 1.5% (1/68) in GET-Evidence
  • Frequency shown in summary reports: 2.2% (238/10748)

Publications
 

Genomes
 

 

hu4040B8 - CGI sample GS01175-DNA_D01 from PGP sample 31286272
het T @ chr19:10395208

 

huD37D14 - CGI sample GS01175-DNA_A04 from PGP sample 13272228
het T @ chr19:10395208

 

GS06985 - var-GS06985-1100-36-ASM
het T @ chr19:10256208

 

Other external references
 

    dbSNP
  • rs1801714
    www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi
    PolyPhen-2
  • Score: 0.729 (possibly damaging)
    Web search results (36 hits -- see all)
  • GeneCanvas
    The nomenclature system used for polymorphisms is the following : Polymorphisms in the 5' ... ICAM1/-841del/ins. ICAM1/G241R. ICAM1/K469E. ICAM1/P352L. ICAM3/A2A. ICAM3 ...
    genecanvas.ecgene.net/infusions/.../PolymorphismsList.php
  • ICAM1 R241 is not associated with celiac disease in the ...
    The ICAM1 gene, located in the CD linkage region 19p13, encodes an intercellular adhesion ... R478W (rs5030400), P352L (rs1801714) and G241R (rs1799969); and one ...
    www.ncbi.nlm.nih.gov/pubmed/18703101
  • ICAM1 Gene - GeneCards | ICAM1 Protein | ICAM1 Antibody
    leukocyte trans-endothelial migration, ICAM1 engagement promotes the assembly of ... ICAM1 Gene in genomic location: bands according to Ensembl, locations according ...
    genecards.org/cgi-bin/carddisp.pl?gene=ICAM1&...+AND+tongue
  • ICAM1 R241 is not associated with celiac disease in the ...
    ICAM1 R241 is not associated with celiac disease in the Spanish population. ... R478W (rs5030400), P352L (rs1801714) and G241R (rs1799969); and one ...
    www.infodoctor.org:8080/uid=18703101
  • LS-SNP Query Results
    ICAM1. rs1801714. chr19. 10242836. 10256960. 10256208. 2. C/T. ICAM1. rs5497 ... 10256468. 2. A/G. ICAM1. rs13306430. chr19. 10242836. 10256960. 10256624. 2. A/G. ICAM1 ...
    modbase.compbio.ucsf.edu/LS-SNP-cgi/LS_SNP_query.pl?...
  • LS-SNP Query Results
    ICAM1. rs5497. P05362. RQ. 397. buried charge change. ICAM1. rs5492. P05362. KN. 155. ICAM1. rs5498 ... ICAM1. rs1801714. P05362. PL. 352. PO4. ICAM2. rs5504. P13598. RH. 199. ICAM2 ...
    modbase.compbio.ucsf.edu/LS-SNP-cgi/LS_SNP_query.pl?...
  • *Search results for ICAM1*
    ... ICAM1 rs1059855 C/T 10106.473 CTCCACGGAGAGCCCAGACGGGCTT TGCATCCATTCCCTCTTTTTGTTTT ICAM1 ... France, Scotland (1000 individuals) rs1801714 ICAM1 rs281436 A/G 10157.667 ...
    cedar.genetics.soton.ac.uk/cgi-bin/runsearch22g?ICAM1::19
  • ASSAY_ID ASSAY_CODE CHROMOSOME_NAME HUGO_NAME GENE_CODE
    ICAM1_2. chr19. ICAM1. ICAM1. TGCAGCACCTCCTGTGACCAGCCCA(T/A)GTTGTTGGGCATAGAGACCCCGTTG ... rs1801714. 255. 112. ICAM1_7. chr19. ICAM1. ICAM1. GAGCACTCAAGGGGAGGTCACCCGC ...
    med.stanford.edu/advance/documents/snps_phase_I.xls
  • Intercellular adhesion molecule 1 precursor - Homo sapiens (Human)
    During leukocyte trans-endothelial migration, ICAM1 engagement promotes the assembly of ... Homozygotes with ICAM1-Kalifi Met-56 seem to have an increased risk ...
    www.uniprot.org/uniprot/P05362

Other in silico analyses
 

  • NBLOSUM100 score = 7
  • GET-Evidence autoscore = 2

Edit history
 

Gene search

"GENE" or "GENE A123C":

Log in