FAM20C I320Shift - GET-Evidence

Note: This variant has not been sufficiently evaluated by a GET-Evidence editor.

To be considered sufficiently evaluated a variant must have both "variant evidence" and "clinical importance" scores filled in.

Please help improve GET-Evidence by evaluating evidence for this variant!

Curation:
Currentness:

FAM20C I320Shift

(FAM20C 320delIinsShift)


Short summary

 

Variant evidence
Computational -
Functional -
Case/Control -
Familial -
 
Clinical importance
Severity -
Treatability -
Penetrance -
 

Impact

Insufficiently evaluated not reviewed

(The "insufficiently evaluated" qualifier is assigned automatically based on the above evidence and importance scores.)

Inheritance pattern

unknown

Summary of published research, and additional commentary

 

Allele frequency

  • None available.

Publications
 

Genomes
 

hu04FD18 - CGI sample GS00253-DNA_F01_200_37
het GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

hu0E64A1 - CGI sample GS01173-DNA_B02 from PGP sample 94378523
het GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

hu241DEA - CGI sample GS01175-DNA_D05 from PGP sample 1205491
het GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

hu2D6140 - CGI sample GS01173-DNA_F06 from PGP sample 64191565
hom GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

hu342A08 - CGI sample GS01175-DNA_B05 from PGP sample 83494370
het GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

hu3CAB43 - CGI sample GS01175-DNA_D03 from PGP sample 27486199
het GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

hu4040B8 - CGI sample GS01175-DNA_D01 from PGP sample 31286272
het GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

hu604D39 - CGI sample GS00253-DNA_B02_200_37
het GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

hu7A4AD1 - CGI sample GS01669-DNA_C05 from PGP sample 42408046
het GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

hu8229AE - CGI sample GS01173-DNA_A07 from PGP sample 96240009
hom GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

hu92C40A - CGI sample GS01175-DNA_G03 from PGP sample 92527586
het GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

hu92FD55 - CGI sample GS01669-DNA_A04 from PGP sample 08188426
het GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

huAE4A11 - CGI sample GS01669-DNA_F02 from PGP sample 40767107
het GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

huB1FD55 - CGI sample GS01173-DNA_B07 from PGP sample 61499538
het GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

huCA017E - CGI sample GS01175-DNA_B01 from PGP sample 86206034
het GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

huFFAD87 - CGI sample GS01669-DNA_H05 from PGP sample 10971581
hom GACAGGTGAGCCCTTCCTTCCTCCCTCCATCC @ chr7:286469

 

Other in silico analyses
 

  • NBLOSUM100 score = 4
  • GET-Evidence autoscore = 2

Edit history
 

Gene search

"GENE" or "GENE A123C":

Log in