DUOX2 P138L - GET-Evidence

Note: This variant has not been sufficiently evaluated by a GET-Evidence editor.

To be considered sufficiently evaluated a variant must have both "variant evidence" and "clinical importance" scores filled in.

Please help improve GET-Evidence by evaluating evidence for this variant!



(DUOX2 Pro138Leu)

Short summary


Variant evidence
Computational -
Functional -
Case/Control -
Familial -
Clinical importance
Severity -
Treatability -
Penetrance -


Insufficiently evaluated not reviewed

(The "insufficiently evaluated" qualifier is assigned automatically based on the above evidence and importance scores.)

Inheritance pattern


Summary of published research, and additional commentary


Allele frequency

  • A @ chr15:45404066: 74.1% (7973/10758) in EVS
  • A @ chr15:43191357: 74.6% (94/126) in GET-Evidence
  • Frequency shown in summary reports: 74.1% (7973/10758)



hu011C57 - CGI sample GS01669-DNA_B05 from PGP sample 86486261
hom A @ chr15:45404066


hu025CEA - CGI sample GS01669-DNA_D02 from PGP sample 27316983
hom A @ chr15:45404066


hu034DB1 - CGI sample GS00253-DNA_A02_200_37
het A @ chr15:45404066


hu04FD18 - CGI sample GS00253-DNA_F01_200_37
het A @ chr15:45404066


hu0D879F - CGI sample GS00253-DNA_G01_200_37
hom A @ chr15:45404066


hu0E64A1 - CGI sample GS01173-DNA_B02 from PGP sample 94378523
het A @ chr15:45404066



hu241DEA - CGI sample GS01175-DNA_D05 from PGP sample 1205491
hom A @ chr15:45404066


hu2D6140 - CGI sample GS01173-DNA_F06 from PGP sample 64191565
hom A @ chr15:45404066


hu2DBF2D - CGI sample GS01173-DNA_G02 from PGP sample 67180598
het A @ chr15:45404066


hu342A08 - CGI sample GS01175-DNA_B05 from PGP sample 83494370
hom A @ chr15:45404066



hu38168C - CGI sample GS01173-DNA_H06 from PGP sample 91708424
hom A @ chr15:45404066



hu3CAB43 - CGI sample GS01175-DNA_D03 from PGP sample 27486199
hom A @ chr15:45404066


hu4040B8 - CGI sample GS01175-DNA_D01 from PGP sample 31286272
hom A @ chr15:45404066


hu4339C0 - CGI sample GS01175-DNA_H01 from PGP sample 94797469
hom A @ chr15:45404066


hu43860C - CGI sample GS00253-DNA_A01_200_37
het A @ chr15:45404066


hu44DCFF - CGI sample GS01669-DNA_C07 from PGP sample 74521372
hom A @ chr15:45404066


hu4CA5B9 - CGI sample GS01669-DNA_B03 from PGP sample 14427241
hom A @ chr15:45404066



hu72A81D - CGI sample GS01173-DNA_C02 from PGP sample 10366372
het A @ chr15:45404066


hu7A4AD1 - CGI sample GS01669-DNA_C05 from PGP sample 42408046
hom A @ chr15:45404066


hu8229AE - CGI sample GS01173-DNA_A07 from PGP sample 96240009
hom A @ chr15:45404066


hu92C40A - CGI sample GS01175-DNA_G03 from PGP sample 92527586
hom A @ chr15:45404066


hu92FD55 - CGI sample GS01669-DNA_A04 from PGP sample 08188426
het A @ chr15:45404066


hu9385BA - CGI sample GS00253-DNA_E01_200_37
hom A @ chr15:45404066


huA0E089 - CGI sample GS01175-DNA_B04 from PGP sample 88590671
hom A @ chr15:45404066



huAE4A11 - CGI sample GS01669-DNA_F02 from PGP sample 40767107
hom A @ chr15:45404066


huAE6220 - CGI sample GS00253-DNA_H01_200_37
hom A @ chr15:45404066


huB1FD55 - CGI sample GS01173-DNA_B07 from PGP sample 61499538
hom A @ chr15:45404066


huBAAC98 - CGI sample GS01173-DNA_F02 from PGP sample 70008981
hom A @ chr15:45404066


huBEDA0B - CGI sample GS00253-DNA_C01_200_37
hom A @ chr15:45404066


huC30901 - CGI sample GS00253-DNA_B01_200_37
hom A @ chr15:45404066


huCA017E - CGI sample GS01175-DNA_B01 from PGP sample 86206034
hom A @ chr15:45404066


huD37D14 - CGI sample GS01175-DNA_A04 from PGP sample 13272228
hom A @ chr15:45404066


huD81F3D - CGI sample GS01173-DNA_D06 from PGP sample 69488604
hom A @ chr15:45404066


huE80E3D - CGI sample GS00253-DNA_D01_200_37
het A @ chr15:45404066


huFAF983 - CGI sample GS01175-DNA_F02 from PGP sample 95788191
het A @ chr15:45404066


huFFAD87 - CGI sample GS01669-DNA_H05 from PGP sample 10971581
het A @ chr15:45404066


GS06985 - var-GS06985-1100-36-ASM
hom A @ chr15:43191358


GS06994 - var-GS06994-1100-36-ASM
hom A @ chr15:43191358


GS07357 - var-GS07357-1100-36-ASM
hom A @ chr15:43191358


GS10851 - var-GS10851-1100-36-ASM
het A @ chr15:43191358


GS12004 - var-GS12004-1100-36-ASM
hom A @ chr15:43191358


GS18501 - var-GS18501-1100-36-ASM
het A @ chr15:43191358


GS18502 - var-GS18502-1100-36-ASM
hom A @ chr15:43191358


GS18526 - var-GS18526-1100-36-ASM
hom A @ chr15:43191358


GS18537 - var-GS18537-1100-36-ASM
het A @ chr15:43191358


GS18555 - var-GS18555-1100-36-ASM
hom A @ chr15:43191358


GS18558 - var-GS18558-1100-36-ASM
hom A @ chr15:43191358


GS18940 - var-GS18940-1100-36-ASM
hom A @ chr15:43191358


GS18942 - var-GS18942-1100-36-ASM
hom A @ chr15:43191358


GS18947 - var-GS18947-1100-36-ASM
hom A @ chr15:43191358


GS18956 - var-GS18956-1100-36-ASM
hom A @ chr15:43191358


GS19025 - var-GS19025-1100-36-ASM
hom A @ chr15:43191358


GS19026 - var-GS19026-1100-36-ASM
hom A @ chr15:43191358


GS19129 - var-GS19129-1100-36-ASM
hom A @ chr15:43191358


GS19238 - var-GS19238-1100-36-ASM
het A @ chr15:43191358


GS19239 - var-GS19239-1100-36-ASM
het A @ chr15:43191358


GS19240 - var-GS19240-1100-36-ASM
het A @ chr15:43191358


GS19648 - var-GS19648-1100-36-ASM
hom A @ chr15:43191358


GS19649 - var-GS19649-1100-36-ASM
het A @ chr15:43191358


GS19669 - var-GS19669-1100-36-ASM
het A @ chr15:43191358


GS19670 - var-GS19670-1100-36-ASM
hom A @ chr15:43191358


GS19700 - var-GS19700-1100-36-ASM
het A @ chr15:43191358


GS19703 - var-GS19703-1100-36-ASM
het A @ chr15:43191358


GS19735 - var-GS19735-1100-36-ASM
hom A @ chr15:43191358


GS19834 - var-GS19834-1100-36-ASM
het A @ chr15:43191358


GS20502 - var-GS20502-1100-36-ASM
hom A @ chr15:43191358


GS20509 - var-GS20509-1100-36-ASM
hom A @ chr15:43191358


GS21767 - var-GS21767-1100-36-ASM
hom A @ chr15:43191358


Other external references

  • rs2001616
    Web search results (9 hits -- see all)
  • Genetic polymorphisms and susceptibility to lung disease
    Mutations in DUOX2 have been shown to be associated with mild hypothyroidism 222324. ... DUOX2 Ex17R. ACTCCTTAGGGATCTTGAGCAG. DUOX2 Ex24F. GATGCCTGCCAGATCCCCAG ...
  • Journal of Negative Results in BioMedicine
    DUOX2, are transmembrane proteins which transport. electrons and generate reactive oxygen ... Mutations in DUOX2 have been shown to be. associated with mild hypothyroidism [22-24] ...

Other in silico analyses

  • NBLOSUM100 score = 7
  • GET-Evidence autoscore = 2

Edit history

Gene search

"GENE" or "GENE A123C":

Log in