CRIPAK C27Shift - GET-Evidence

Note: This variant has not been sufficiently evaluated by a GET-Evidence editor.

To be considered sufficiently evaluated a variant must have both "variant evidence" and "clinical importance" scores filled in.

Please help improve GET-Evidence by evaluating evidence for this variant!

Curation:
Currentness:

CRIPAK C27Shift

(CRIPAK 27delCinsShift)


Short summary

 

Variant evidence
Computational -
Functional -
Case/Control -
Familial -
 
Clinical importance
Severity -
Treatability -
Penetrance -
 

Impact

Insufficiently evaluated not reviewed

(The "insufficiently evaluated" qualifier is assigned automatically based on the above evidence and importance scores.)

Inheritance pattern

unknown

Summary of published research, and additional commentary

 

Allele frequency

  • None available.

Publications
 

Genomes
 

hu0D879F - CGI sample GS00253-DNA_G01_200_37
het TGCCCATGTGGAGTGCCCGCCTGCTCACACA @ chr4:1388351

 

hu4040B8 - CGI sample GS01175-DNA_D01 from PGP sample 31286272
het TGCCCATGTGGAGTGCCCGCCTGCTCACACA @ chr4:1388351

 

hu4CA5B9 - CGI sample GS01669-DNA_B03 from PGP sample 14427241
het TGCCCATGTGGAGTGCCCGCCTGCTCACACA @ chr4:1388351

 

hu72A81D - CGI sample GS01173-DNA_C02 from PGP sample 10366372
het TGCCCATGTGGAGTGCCCGCCTGCTCACACA @ chr4:1388351

 

huD81F3D - CGI sample GS01173-DNA_D06 from PGP sample 69488604
het TGCCCATGTGGAGTGCCCGCCTGCTCACACA @ chr4:1388351

 

huE80E3D - CGI sample GS00253-DNA_D01_200_37
het TGCCCATGTGGAGTGCCCGCCTGCTCACACA @ chr4:1388351

 

huFFAD87 - CGI sample GS01669-DNA_H05 from PGP sample 10971581
het TGCCCATGTGGAGTGCCCGCCTGCTCACACA @ chr4:1388351

 

Other in silico analyses
 

  • NBLOSUM100 score = 4
  • GET-Evidence autoscore = 2

Edit history
 

Gene search

"GENE" or "GENE A123C":

Log in