CHIT1 V357VX - GET-Evidence

Note: This variant has not been sufficiently evaluated by a GET-Evidence editor.

To be considered sufficiently evaluated a variant must have both "variant evidence" and "clinical importance" scores filled in.

Please help improve GET-Evidence by evaluating evidence for this variant!



(CHIT1 357delVinsVX)

Short summary


Variant evidence
Computational -
Functional -
Case/Control -
Familial -
Clinical importance
Severity -
Treatability -
Penetrance -


Insufficiently evaluated not reviewed

(The "insufficiently evaluated" qualifier is assigned automatically based on the above evidence and importance scores.)

Inheritance pattern


Summary of published research, and additional commentary


Allele frequency

  • CCATGGCCCCGCCCAGTCCCTAGA @ chr1:201453576: 1.6% (2/128) in GET-Evidence
  • Frequency shown in summary reports: 1.6% (2/128)



hu025CEA - CGI sample GS01669-DNA_D02 from PGP sample 27316983


hu034DB1 - CGI sample GS00253-DNA_A02_200_37


hu0D879F - CGI sample GS00253-DNA_G01_200_37


hu0E64A1 - CGI sample GS01173-DNA_B02 from PGP sample 94378523


hu241DEA - CGI sample GS01175-DNA_D05 from PGP sample 1205491


hu38168C - CGI sample GS01173-DNA_H06 from PGP sample 91708424


hu43860C - CGI sample GS00253-DNA_A01_200_37


hu4CA5B9 - CGI sample GS01669-DNA_B03 from PGP sample 14427241


hu72A81D - CGI sample GS01173-DNA_C02 from PGP sample 10366372


hu92C40A - CGI sample GS01175-DNA_G03 from PGP sample 92527586


hu92FD55 - CGI sample GS01669-DNA_A04 from PGP sample 08188426


huA0E089 - CGI sample GS01175-DNA_B04 from PGP sample 88590671



huAE4A11 - CGI sample GS01669-DNA_F02 from PGP sample 40767107


huC30901 - CGI sample GS00253-DNA_B01_200_37


huCA017E - CGI sample GS01175-DNA_B01 from PGP sample 86206034


huD37D14 - CGI sample GS01175-DNA_A04 from PGP sample 13272228


huD81F3D - CGI sample GS01173-DNA_D06 from PGP sample 69488604


huE80E3D - CGI sample GS00253-DNA_D01_200_37


GS07357 - var-GS07357-1100-36-ASM


GS18526 - var-GS18526-1100-36-ASM


GS18537 - var-GS18537-1100-36-ASM


GS18555 - var-GS18555-1100-36-ASM


GS18558 - var-GS18558-1100-36-ASM


GS18942 - var-GS18942-1100-36-ASM


GS18947 - var-GS18947-1100-36-ASM


GS18956 - var-GS18956-1100-36-ASM


GS19649 - var-GS19649-1100-36-ASM


GS19670 - var-GS19670-1100-36-ASM


GS19735 - var-GS19735-1100-36-ASM


GS20509 - var-GS20509-1100-36-ASM


Other external references

  • rs3831317

Other in silico analyses

  • NBLOSUM100 score = 10
  • GET-Evidence autoscore = 2

Edit history

Gene search

"GENE" or "GENE A123C":

Log in