C16ORF85 R98Shift - GET-Evidence

Note: This variant has not been sufficiently evaluated by a GET-Evidence editor.

To be considered sufficiently evaluated a variant must have both "variant evidence" and "clinical importance" scores filled in.

Please help improve GET-Evidence by evaluating evidence for this variant!

Curation:
Currentness:

C16ORF85 R98Shift

(C16ORF85 98delRinsShift)


Short summary

 

Variant evidence
Computational -
Functional -
Case/Control -
Familial -
 
Clinical importance
Severity -
Treatability -
Penetrance -
 

Impact

Insufficiently evaluated not reviewed

(The "insufficiently evaluated" qualifier is assigned automatically based on the above evidence and importance scores.)

Inheritance pattern

unknown

Summary of published research, and additional commentary

 

Allele frequency

  • None available.

Publications
 

Genomes
 

hu0D879F - CGI sample GS00253-DNA_G01_200_37
het CGCAGTGCAGAGCTGGGACGGACGCC @ chr16:88620346

 

hu2D6140 - CGI sample GS01173-DNA_F06 from PGP sample 64191565
het CGCAGTGCAGAGCTGGGACGGACGCC @ chr16:88620346

 

hu342A08 - CGI sample GS01175-DNA_B05 from PGP sample 83494370
het CGCAGTGCAGAGCTGGGACGGACGCC @ chr16:88620346

 

hu4339C0 - CGI sample GS01175-DNA_H01 from PGP sample 94797469
het CGCAGTGCAGAGCTGGGACGGACGCC @ chr16:88620346

 

huA0E089 - CGI sample GS01175-DNA_B04 from PGP sample 88590671
het CGCAGTGCAGAGCTGGGACGGACGCC @ chr16:88620346

 

huAE4A11 - CGI sample GS01669-DNA_F02 from PGP sample 40767107
het CGCAGTGCAGAGCTGGGACGGACGCC @ chr16:88620346

 

huBAAC98 - CGI sample GS01173-DNA_F02 from PGP sample 70008981
het CGCAGTGCAGAGCTGGGACGGACGCC @ chr16:88620346

 

huD37D14 - CGI sample GS01175-DNA_A04 from PGP sample 13272228
het CGCAGTGCAGAGCTGGGACGGACGCC @ chr16:88620346

 

huFAF983 - CGI sample GS01175-DNA_F02 from PGP sample 95788191
het CGCAGTGCAGAGCTGGGACGGACGCC @ chr16:88620346

 

huFFAD87 - CGI sample GS01669-DNA_H05 from PGP sample 10971581
het CGCAGTGCAGAGCTGGGACGGACGCC @ chr16:88620346

 

Other external references
 

    dbSNP
  • rs11270667
    www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi

Other in silico analyses
 

  • NBLOSUM100 score = 4
  • GET-Evidence autoscore = 2

Edit history
 

Gene search

"GENE" or "GENE A123C":

Log in